ID: 1029169088_1029169103

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1029169088 1029169103
Species Human (GRCh38) Human (GRCh38)
Location 7:98618075-98618097 7:98618126-98618148
Sequence CCCTTCCCACACCGCTGCTCTTG CGCGCGTCGGGACTGCCAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 240} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!