ID: 1029170785_1029170795

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1029170785 1029170795
Species Human (GRCh38) Human (GRCh38)
Location 7:98627809-98627831 7:98627845-98627867
Sequence CCCTGCTCAGGGTCTTAACCCTG GGCACTTAGGTAATCCATAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!