ID: 1029188444_1029188456

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1029188444 1029188456
Species Human (GRCh38) Human (GRCh38)
Location 7:98755534-98755556 7:98755579-98755601
Sequence CCAGGCACCTTCTCCACCTCCCA CTGTAGTTCAGGAGGAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 719} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!