ID: 1029199782_1029199786

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1029199782 1029199786
Species Human (GRCh38) Human (GRCh38)
Location 7:98831183-98831205 7:98831212-98831234
Sequence CCTAGCACATTCTAAGTGCTCCA GCAGCTATCACTATGGTGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!