ID: 1029209899_1029209904

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1029209899 1029209904
Species Human (GRCh38) Human (GRCh38)
Location 7:98898630-98898652 7:98898670-98898692
Sequence CCATTGCCCATCTGTATTTTGAG TTCATGAGTCCTTATATATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 323} {0: 1, 1: 0, 2: 7, 3: 36, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!