ID: 1029234174_1029234180

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1029234174 1029234180
Species Human (GRCh38) Human (GRCh38)
Location 7:99099539-99099561 7:99099584-99099606
Sequence CCACTGCTGTGGTTTGGTCTGTC TTTGATCCCCACTGTGGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 186} {0: 1, 1: 2, 2: 2, 3: 39, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!