ID: 1029238671_1029238695

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1029238671 1029238695
Species Human (GRCh38) Human (GRCh38)
Location 7:99143615-99143637 7:99143668-99143690
Sequence CCTGGGACAACGGCCGGCGTGGG GAATTCCGGGGCGGGCGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79} {0: 1, 1: 0, 2: 0, 3: 55, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!