ID: 1029243064_1029243069

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1029243064 1029243069
Species Human (GRCh38) Human (GRCh38)
Location 7:99178151-99178173 7:99178197-99178219
Sequence CCGAGTGGAAGCAGACCAAAGGC CAATTTCACTTTTCCCAAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 167} {0: 1, 1: 0, 2: 1, 3: 40, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!