ID: 1029243291_1029243300

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1029243291 1029243300
Species Human (GRCh38) Human (GRCh38)
Location 7:99179967-99179989 7:99179997-99180019
Sequence CCTGTGTAGTTCCCCACCCACAT GGATGACCTGTGTAACCAATAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 17, 3: 57, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!