ID: 1029259778_1029259784

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1029259778 1029259784
Species Human (GRCh38) Human (GRCh38)
Location 7:99293997-99294019 7:99294014-99294036
Sequence CCCTCTGGCCCTCATTTGCAGGA GCAGGAGGAAGCTGGCCGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 34, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!