|
Left Crispr |
Right Crispr |
| Crispr ID |
1029296788 |
1029296796 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:99546605-99546627
|
7:99546634-99546656
|
| Sequence |
CCCACCTCGGTCTCCCACTGCTG |
CAGGCGTAAGCCACCACACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 43, 3: 256, 4: 1267} |
{0: 224, 1: 6834, 2: 39826, 3: 122873, 4: 212164} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|