ID: 1029298814_1029298817

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1029298814 1029298817
Species Human (GRCh38) Human (GRCh38)
Location 7:99562349-99562371 7:99562391-99562413
Sequence CCAGGATGTGTTATTTCAGGAGT GGCTGTGCACCTTACTCGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 193} {0: 1, 1: 1, 2: 1, 3: 3, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!