ID: 1029307607_1029307614

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1029307607 1029307614
Species Human (GRCh38) Human (GRCh38)
Location 7:99631982-99632004 7:99631996-99632018
Sequence CCCAGAGGGTGGTTTTCCAAAGG TTCCAAAGGCAGGTGGGGACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 144} {0: 1, 1: 0, 2: 1, 3: 24, 4: 300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!