ID: 1029310958_1029310963

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1029310958 1029310963
Species Human (GRCh38) Human (GRCh38)
Location 7:99663804-99663826 7:99663817-99663839
Sequence CCTTCCCCAATCTCCTTCTTTAT CCTTCTTTATTTCTACCAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 705} {0: 1, 1: 0, 2: 4, 3: 21, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!