ID: 1029315631_1029315637

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1029315631 1029315637
Species Human (GRCh38) Human (GRCh38)
Location 7:99710700-99710722 7:99710718-99710740
Sequence CCTCCCTCCTTCTCCATGTACTG TACTGTCCACTCACCTTATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 28, 4: 389} {0: 1, 1: 0, 2: 1, 3: 5, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!