ID: 1029318192_1029318200

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1029318192 1029318200
Species Human (GRCh38) Human (GRCh38)
Location 7:99733627-99733649 7:99733678-99733700
Sequence CCTTGTGTCCAGGCTTCAAGCAG GTGACCTCCACTAGGGGGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 9, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!