ID: 1029319035_1029319043

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1029319035 1029319043
Species Human (GRCh38) Human (GRCh38)
Location 7:99741149-99741171 7:99741191-99741213
Sequence CCCTGGGCAGTACTTATCCAGGG AGACAGCATCTCAAAAAACATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 66} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!