ID: 1029323103_1029323108

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1029323103 1029323108
Species Human (GRCh38) Human (GRCh38)
Location 7:99782571-99782593 7:99782614-99782636
Sequence CCAGGCTTCAAGCAGATGAGATG GTGACCTCCACTACGGGGCCAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 0, 3: 20, 4: 178} {0: 1, 1: 1, 2: 2, 3: 6, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!