ID: 1029344285_1029344293

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1029344285 1029344293
Species Human (GRCh38) Human (GRCh38)
Location 7:99967202-99967224 7:99967243-99967265
Sequence CCTGGGTAGAAGTCGTAGGCCAG TTCTCCTGGGGCCTGGTGGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 74} {0: 2, 1: 0, 2: 2, 3: 48, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!