ID: 1029358591_1029358595

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1029358591 1029358595
Species Human (GRCh38) Human (GRCh38)
Location 7:100071515-100071537 7:100071530-100071552
Sequence CCTGCTGAAGGCCTTCCCACATT CCCACATTCATTGCAGGCGTAGG
Strand - +
Off-target summary {0: 3, 1: 7, 2: 29, 3: 113, 4: 351} {0: 1, 1: 1, 2: 4, 3: 29, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!