ID: 1029371485_1029371496

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1029371485 1029371496
Species Human (GRCh38) Human (GRCh38)
Location 7:100153763-100153785 7:100153816-100153838
Sequence CCAGCCAATGTGCGTGTGGCCCC CTGTGCTCCCTTCCCTCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 95} {0: 1, 1: 1, 2: 2, 3: 65, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!