ID: 1029404198_1029404206

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1029404198 1029404206
Species Human (GRCh38) Human (GRCh38)
Location 7:100364432-100364454 7:100364477-100364499
Sequence CCCATGGTTTTTATTCCACAGGG GGTGAAGTATGATCACATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 197} {0: 1, 1: 0, 2: 2, 3: 38, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!