ID: 1029410096_1029410106

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1029410096 1029410106
Species Human (GRCh38) Human (GRCh38)
Location 7:100403967-100403989 7:100404009-100404031
Sequence CCCTCCCCATTCTGTTTCTCCCA GCCCATCCATCCTAGATACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 671} {0: 1, 1: 0, 2: 1, 3: 8, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!