ID: 1029414170_1029414177

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1029414170 1029414177
Species Human (GRCh38) Human (GRCh38)
Location 7:100432690-100432712 7:100432719-100432741
Sequence CCGTCGACCTTTTTTGGCTTACC AGGAAGAAGCAGAGGCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72} {0: 1, 1: 0, 2: 29, 3: 295, 4: 2812}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!