ID: 1029414919_1029414926

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1029414919 1029414926
Species Human (GRCh38) Human (GRCh38)
Location 7:100436472-100436494 7:100436493-100436515
Sequence CCTAGACGCCGCTACCGGAAACC CCGTTAACCCTTTCCTTCGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 0, 4: 17} {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!