ID: 1029420192_1029420201

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1029420192 1029420201
Species Human (GRCh38) Human (GRCh38)
Location 7:100468112-100468134 7:100468135-100468157
Sequence CCCAAGGGCAAGGCCTGGCTGCT ATTGGCTCCTTGGGGACACGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!