ID: 1029425312_1029425321

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1029425312 1029425321
Species Human (GRCh38) Human (GRCh38)
Location 7:100490708-100490730 7:100490741-100490763
Sequence CCCGCCTGCCACCGCAATGGAGG TGCACACACCTGTGCACAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} {0: 1, 1: 0, 2: 5, 3: 27, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!