ID: 1029435962_1029435969

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1029435962 1029435969
Species Human (GRCh38) Human (GRCh38)
Location 7:100564210-100564232 7:100564231-100564253
Sequence CCCCCTAGGCTCTTCCTTCGGGG GGACTTAGGATCAGCCAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 108} {0: 1, 1: 0, 2: 0, 3: 4, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!