ID: 1029457188_1029457196

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1029457188 1029457196
Species Human (GRCh38) Human (GRCh38)
Location 7:100677332-100677354 7:100677356-100677378
Sequence CCTACACCGTTCCCCACCAGGCT CTGGTCAGCGCCTCCCAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 201} {0: 1, 1: 0, 2: 0, 3: 22, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!