ID: 1029467894_1029467900

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1029467894 1029467900
Species Human (GRCh38) Human (GRCh38)
Location 7:100737385-100737407 7:100737405-100737427
Sequence CCCTTTTCTCTCCGTCCTTGCAC CACAACAAGAAGAGGATCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 684} {0: 1, 1: 1, 2: 0, 3: 12, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!