ID: 1029469970_1029469978

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1029469970 1029469978
Species Human (GRCh38) Human (GRCh38)
Location 7:100748173-100748195 7:100748214-100748236
Sequence CCAGCTGTGGCAGTTGATGCAAC GGGTGAGAGCAGGCCCTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 109} {0: 1, 1: 0, 2: 4, 3: 38, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!