ID: 1029488795_1029488802

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1029488795 1029488802
Species Human (GRCh38) Human (GRCh38)
Location 7:100859110-100859132 7:100859152-100859174
Sequence CCTTCTTCGTCTATGTCCTGCTT CTTGTGACAGGTGTCTGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194} {0: 1, 1: 1, 2: 8, 3: 52, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!