ID: 1029488795_1029488804

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1029488795 1029488804
Species Human (GRCh38) Human (GRCh38)
Location 7:100859110-100859132 7:100859157-100859179
Sequence CCTTCTTCGTCTATGTCCTGCTT GACAGGTGTCTGGGGAGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194} {0: 1, 1: 0, 2: 7, 3: 87, 4: 743}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!