ID: 1029496219_1029496224

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1029496219 1029496224
Species Human (GRCh38) Human (GRCh38)
Location 7:100896602-100896624 7:100896626-100896648
Sequence CCGCACTCCGCGGCGGCAGTGGA ACTTCTGGAACCCCCGCGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56} {0: 1, 1: 0, 2: 0, 3: 4, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!