ID: 1029505411_1029505418

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1029505411 1029505418
Species Human (GRCh38) Human (GRCh38)
Location 7:100960883-100960905 7:100960916-100960938
Sequence CCCAGCACCTTCTATGGTTCCAG GCTGTGGAACAGGTGGATCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 232} {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!