ID: 1029508960_1029508969

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1029508960 1029508969
Species Human (GRCh38) Human (GRCh38)
Location 7:100981353-100981375 7:100981388-100981410
Sequence CCTTGTCCCTCCTGCAGCGAGTG TTGGTGGAGTTTGCTAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 253} {0: 1, 1: 0, 2: 2, 3: 7, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!