ID: 1029514602_1029514608

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1029514602 1029514608
Species Human (GRCh38) Human (GRCh38)
Location 7:101017631-101017653 7:101017676-101017698
Sequence CCCACCCTGGAGACTGTTGACTC CGAGCTGCCCCCACCCCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 157} {0: 1, 1: 0, 2: 2, 3: 27, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!