ID: 1029519571_1029519590

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1029519571 1029519590
Species Human (GRCh38) Human (GRCh38)
Location 7:101051664-101051686 7:101051716-101051738
Sequence CCCAGTACGACCCTGAAGGTAGG GGAGAGGTGGGGAGCCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55} {0: 1, 1: 0, 2: 8, 3: 129, 4: 875}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!