ID: 1029536926_1029536949

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1029536926 1029536949
Species Human (GRCh38) Human (GRCh38)
Location 7:101162769-101162791 7:101162819-101162841
Sequence CCGCCCTCCTGGGCTGGCCCCCG CGGGCTCAGGACCCGGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 56, 4: 525} {0: 1, 1: 0, 2: 1, 3: 25, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!