ID: 1029536940_1029536949

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1029536940 1029536949
Species Human (GRCh38) Human (GRCh38)
Location 7:101162797-101162819 7:101162819-101162841
Sequence CCGCGGGTGAGCTCTGGGAGTTC CGGGCTCAGGACCCGGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 132} {0: 1, 1: 0, 2: 1, 3: 25, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!