ID: 1029540670_1029540682

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1029540670 1029540682
Species Human (GRCh38) Human (GRCh38)
Location 7:101180304-101180326 7:101180344-101180366
Sequence CCCGGCGACGCTCCGGCGGCAGC CCGGCGACGCGGAAGAAACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 94} {0: 1, 1: 0, 2: 0, 3: 0, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!