ID: 1029553039_1029553044

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1029553039 1029553044
Species Human (GRCh38) Human (GRCh38)
Location 7:101248305-101248327 7:101248327-101248349
Sequence CCTTCAGCTCTCAAACCCCTGGT TGGCCACAGCTCCGCTACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!