ID: 1029573853_1029573855

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1029573853 1029573855
Species Human (GRCh38) Human (GRCh38)
Location 7:101390090-101390112 7:101390125-101390147
Sequence CCAATCTAGTGTCATGAAGCTTT ACCTTTTAGGTCTCATGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 50, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!