ID: 1029576307_1029576319

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1029576307 1029576319
Species Human (GRCh38) Human (GRCh38)
Location 7:101405850-101405872 7:101405887-101405909
Sequence CCTTCCCGCCAGTGCGCAGGCAA CTGTGGGGCTGGCTCTCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90} {0: 1, 1: 1, 2: 19, 3: 49, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!