ID: 1029580484_1029580491

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1029580484 1029580491
Species Human (GRCh38) Human (GRCh38)
Location 7:101433795-101433817 7:101433836-101433858
Sequence CCACAGAACACTGAAAGTGATTT CCAACCCAGGAGTGCCTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 307} {0: 1, 1: 0, 2: 1, 3: 10, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!