ID: 1029629619_1029629633

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1029629619 1029629633
Species Human (GRCh38) Human (GRCh38)
Location 7:101742373-101742395 7:101742408-101742430
Sequence CCAAAAAGCCCAGAGGCCCAGCC GGAGGGGGGCCCTGAAGCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 263} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!