ID: 1029629913_1029629918 |
View in Genome Browser |
Spacer: -5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1029629913 | 1029629918 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:101743817-101743839 | 7:101743835-101743857 |
| Sequence | CCAGAGCGACCCCGGATCCGCCC | CGCCCCCGCCCCCCTCCATGAGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||