ID: 1029629934_1029629948

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1029629934 1029629948
Species Human (GRCh38) Human (GRCh38)
Location 7:101743871-101743893 7:101743897-101743919
Sequence CCCCCGGCCCAGGCCACCTCCCC AGCCCACTCTCCGGAGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 109, 4: 1124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!