ID: 1029640636_1029640642

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1029640636 1029640642
Species Human (GRCh38) Human (GRCh38)
Location 7:101817038-101817060 7:101817053-101817075
Sequence CCCGCGGGGGCTCTTTGGGGAAA TGGGGAAACTTGGCGAGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111} {0: 1, 1: 0, 2: 2, 3: 27, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!