ID: 1029646605_1029646610

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1029646605 1029646610
Species Human (GRCh38) Human (GRCh38)
Location 7:101860788-101860810 7:101860830-101860852
Sequence CCTTCCCCTCTCTTCTTCTCTCT AGAGTCTTGTTGTGTCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 124, 3: 1034, 4: 6310} {0: 11, 1: 981, 2: 14277, 3: 52754, 4: 112164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!